SOL Review Packet Name_________key_________________________ Block

________
I. Scientific Investigation

A. Parts of Experimental Design: Match the word bank to the correct definitions

Constants Variables Qualitative data Quantitative data Control

Experiment Dependent Variable Independent variable Hypothesis Mean

1. _Qualitative Data_____________- is the type of data gathered using the 5 senses.

2. _Quantitative Data___________- is the type of data gathered using actual measured numbers.
3. _Hypothesis_________________- is an educated guess/prediction; usually in “IF...THEN” form.
4. _Variables__________________- any factors that can be changed in an experiment.
5. _Independent Variable_______- is the variable that you purposely change...variable “I” change.
6. _Dependent Variable_________- is the variable that changes as a result of changing the IV.
7. _Control_________________- is the standard against which the experimental results are compared.
8. _Constants_________________- the thing(s) that are purposely kept the same in the experiment.
9. _Experiment_______________- is a structured way to test a hypothesis
10. _Mean____________________- the average of the data collected in an experiment
B. Steps of Scientific Method
Place the following steps of the Scientific Method in chronological order:
__6_____Communicate your results
__3_____Construct a hypothesis
__5_____Analyze data and draw conclusions
__1_____Ask a question
__2_____Do background research
__4_____Test the hypothesis (Experimentation)

C. Research Sources: Match the three research sources below with their descriptions

Encyclopedias State/local agencies Scientific journals

a. _Journals____________ are the best place to locate current findings on the newest technologies
b. _Encyclopedias_______ are a good place to find information on extinct species or historical theories
c. _State/local agencies___ can help research the effects of pesticides on the squirrel population

D. Hypothesis, Theory and Law : Rank these three terms in order of increasing experimental support.

Hypothesis Theory Law

1__Hypothesis_______________________
2__Theory___________________________
3__Law______________________________

1
E. Scientific Method : Read the paragraph and fill in the blanks that follow

After studying about recycling, members of John’s biology class investigated the effect of various recycled
products on plant growth. John’s lab group compared the effect of different aged grass compost on bean plants.
Because decomposition is necessary to release the nutrients, the group hypothesized that older grass compost would
produce taller bean plants. Three flats of bean plants (25 plants/ flat) were grown for 5 days. The plants were fertilized
as follows: (a) Flat A: 450 g of three-month-old compost, (b) Flat B: 450 g of six-month-old compost, and (c) Flat C: 0 g
compost. The plants received the same amount of sunlight and water each day. At the end of the 30 days the group
recorded the height of the plants (cm).
Hypothesis: _Plants with older compost will grow taller.______________________________________
______________________________________________________________________________________
IV: _Age of Compost_____________________________________________________________________
DV: _Height of Plants_____________________________________________________________________
control: _Plants without compost___________________________________________________________
constants: _Sunlight, water, bean plant type__________________________________________________

For each, identify the hypothesis, IV, DV, the control and experimental group.
1. The addition of the chemical calcium chloride (CaCl) to water will increase its temperature.
Hypothesis: If _we add CaCl______________________, then _the temperature will increase___________.
Independent Variable: _CaCl_____________________ Dependent Variable: _Temperature____________
Control Group: _Only H20_______________________ Experimental Group: _with CaCl________________
2. Watering a plant with salt water will kill the plant.
Hypothesis: If _we water with salt_________________, then _the plant will die______________________.
Independent Variable: _salt______________________ Dependent Variable: _plant health______________
Control Group: _no vitamins_____________________ Experimental Group: _with salt__________________
3. A person that takes a vitamin supplement has better memory retention.
Hypothesis: If _you take vitamins__________________, then _better memory________________________.
Independent Variable: _Vitamins__________________ Dependent Variable: _memory_________________
Control Group: _no vitamins______________________ Experimental Group: _with vitamins____________
F. Graphs: Look at the Graphs below and answer the questions that follow.

2
In which year was there likely an abundance
of bluegill food?

In which year was there likely an

increase in bluegill predators?

160 mice 10% of vitamins 1996, 1991

G. Microscopes:
1. To find the total magnification you must take the _eye piece_ and multiply it by the
_objective lens_.
2. What is the total magnification used to view these onion cells through this setup?400 X
3. _4____ When viewing a prepared slide under the compound
microscope, a student has to remove his glasses. This means he will
need to readjust for fine focus with which part labeled to the left?
4. _A_ Which of the following came first in the scientific study of living things?
a. light microscopes c. cell theory
b. electron microscope d. model of DNA
5. _Course adjustment knob_- used to make BIG changes in focus
6. _Diaphram_____________ -adjusts the amount of light

H. Interpreting Graphs

What is on the x-axis? _Independent Variable/ Year__

What is on the y-axis? _Dependent Varialbe/ Number of bluegills_
What is the dependent variable? _number of Bluegills_
What is the independent
variable? _year_______
What was the bluegill
population in 1991? _80___
What happened to the
population from 1996 to
2000? _decreased__

3
What is on the x-axis? _Independent________
What is on the y-axis? _Dependent________
What is the dependent variable? _Mass of Fungi__
What is the independent variable? _Days________
Which data point (1-4) is probably invalid? _2____
How many days did it take for the fungi to reach 200 g? _5_

I. Characteristics of Life
1. Organisms are made of one (uni-) or many (multi-) _cells_.
2. Organisms must _reproduce_ to ensure long-term species survival. Can be asexual or sexual.
3. Organisms are based on a universal _code_ (DNA).
4. Organisms have a particular pattern of _growth_ and development throughout life.
5. Organisms obtain and use materials and _energy_. a) Autotrophs – b) Heterotrophs –
6. Organisms detect and respond to _changes_ in their environment.
7. Organisms must maintain a stable internal environment ; called _homeostasis_.
8. Populations of organisms experience genetic change over time; called _evolution_.
J. Scientists
_F____Redi a. all animals made of cells
_G____Pasteur b. all plants made of cells
_B____Schleiden c. all cells come from pre-existing cells
_A____Schwann d. observed cork; named cells
_C____Virchow e. invented microscope; observed “animalcules”
f. maggot/meat experiment to disprove spontaneous generation
_D____Hooke
g. disproved spontaneous generation once and for all
_E____Leeuwenhoek

4
II. Cytology – Study of cell structure and function

A. Cell Theory – 3 Main Points

1) All organisms are composed of 1 or more _cells_.
2) The cell is the basic unit of _structure_and _function___.
3) All cells come from _pre-existing_ cells.
B. Cell Types: For each characteristic, indicate yes or no for Prokaryotes and Eukaryotes

Characteristic Prokaryote Eukaryote

Nucleus? no yes
Membrane-bound organelles? no yes
Genetic material? yes yes
Complex? no yes
Multicellular? no yes
Bacteria? yes no
Mitosis? no yes
Ribosomes? yes yes
Plants and Animals? no yes

C. Differences between plant and animals cells (complete the table by identifying ONLY the differences)

Differences Plant Animal

Size large Large
Different organelles present chloroplast & cell wall centriole & lysosome
Shape due to cell wall Square Circular

D. Cell Transport: In the boxes below, indicate what direction the water moves and what will happen to the cell.

Hypertonic Solution Hypotonic Solution Isotonic Solution

Direction water moves: Direction water moves: Direction water moves:

out of cell into cell equal in & out

A cell in a hypertonic solution A cell in a hypotonic solution A cell in a isotonic solution
will... will... will...

shrink swell stay the same

a. In the picture to the right, are the water molecules

moving into or out of the cell?
into

b. What type of solution is the cell in (hypotonic, hypertonic or istonic)?

hypertonic
c. What will eventually happen to the cell?

5
burst

Match the types of transport to the correct picture:

Exocytosis endocytosis facilitated diffusion active transport

active transport_______ facilitated diffusion_____ exocytosis___________ endocytosis______

E. The Fluid Mosaic Model and Movement through the Cell Membrane

Word Bank: Diffusion, proteins, cell membrane, active transport, phospholipids, energy, low, high, osmosis

The cell membrane is composed of _phospholipids__ and _proteins_. The Fluid Mosaic Model describes the _cell
membrane_. Passive transport is also called _diffusion_ and it doesn’t require _energy_. Passive transport moves
molecules from areas of _high_ to _low_ concentration. _Osmosis_ is a type of diffusion involving only the movement
of water molecules. A nonspecific type of movement that requires energy is _active transport_ which moves molecules
from low to high concentration.

What is meant by the terms turgor pressure and plasmolysis?

turgur pressure- amount of water pressure needed to hold shape.
plasmolysis- not enough water pressure to hold cell membrane

What is a selectively permeable membrane?

only some things are able to pass through

What is a concentration gradient?

the difference in the amount of molecules inside and outside the cell

6
III. Biochemistry

A. Water: Use the following word bank to fill in the blanks that follow
hydrogen bonding floats acids temperature capillary action water polar 7 4 14 0
adhesion cohesion solvent bases high heat of vaporization homeostasis surface tension
a. Water molecules have a slightly negative charge at one end and a slightly positive charge at the other end. This
means that the molecule is _Polar_.
b. _Cohesion__ is the attraction between the positive end of one water molecule and the negative end of another
water molecule.
c. Many of the 5 unique properties of water are caused by hydrogen bonding
~ _Capillary Action_ is the movement of water up thin plant tubes, caused by _Adhesion__
which means that water molecules ‘stick’ to other things.
~ The property that helps bugs stand on water is _Surface Tension__________________________.
~ Water expands when it freezes which makes ice _Float___________.
~ Water has a _high heat of vaporization_, so it takes a lot of energy to change from a liquid to a gas. This helps
organisms maintain the amount of water they have in their bodies.
~ Water resists temperature change so organisms maintain _homeostasis_____________________ and keep a
constant _temperature_.
d. Because water is a polar molecule, it can dissolve many substances and is sometimes called “The _Universal
Solvent_”.
e. Cells are 95% _water_, therefore 95% of your entire body is made of water.
B. Water chemistry
Draw two water molecules – label the *atom names, *relative charges, and show *where a hydrogen bond would form.
+ + Hydrogen on top

- Oxygen on bottom
Fill in the Blank Using the Following Words: dissolve, heat, freezing, cool, surface tension, cohesion, adhesion, polar
*Because of the relative negative and positive ends of a water molecule, it is considered _polar______________.
*_Cohesion_ - the property of water, due to hydrogen bonds, that allows it to stick to itself
*_Adhesion_- the property of water that allows it to stick to other molecules
*_Surface tension_ - a special case of cohesion; this is why bugs can walk on water and the dome forms on a penny
*Solid form floats, preventing lakes and oceans from _freezing_ solid.
* Water can absorb huge amounts of _heat_, which helps stabilize air temperatures around the globe.
*Water absorbs heat when it evaporates, allowing organisms to _cool_ to release excess heat.
*Water is able to _dissolve_ many substances (it is a good solvent) so the water inside and outside of cells is able to
carry nutrients (solutes) into and around cells, and wastes (also solutes) away from cells.
*What is the strongest acid listed in Figure 2–2? Hydrochloric pH Values of Some Common Substances
acid Figure 2-2 _____________________________________ Substance pH
*What is the pH of the weakest acid listed in Figure 2-2? Hydrochloric acid 1.0
_6.2____________________________________ Sulfuric acid 1.2
Tomatoes 4.2
*What is the pH of the strongest base listed in Figure 2-
Rainwater 6.2
2?
Pure water 7.0
_13.0____________________________________ Sea water 8.5
Ammonium chloride 11.1
Sodium hydroxide 13.0

7
C. Organic Molecules: Place the following characteristics and diagrams into one of the four categories of organic
compounds.
Monomer: nucleotide Monomer: fatty acid Monomer: amino acid
Monomer: monosaccharide Glucose, fructose & sucrose steroids Waxes & phospholipids
DNA & RNA Enzymes, hemoglobin, & actin Found in the nucleus of cells
Made at the ribosome of the cell Sugars Fats
Lots are found in muscle cells

Carbohydrates Nucleic Acid

Monomer: Monosaccharide
Monomer: Nucleotide
Lots found in Muscle Cells-Energy
DNA, RNA, Found in the nucleus of cells
Glucose, Fructose & Sugar Sucrose

Protein Lipid

Monomer: Amino acids

Made in Ribosomes, Enzymes, Hemoglobin, Monomer: Fatty Acid, Waxes, &

Actin Phospholipids, fats

D. Enzymes
Fill in the Blank Using the Following Words:

substrate, active site, denature, protein, -ase, catalyzes, activation

*Special kind of _Protein_ (macromolecule) that _Catalyzes_ (speeds up) chemical reactions.
*_Denature_ - when the shape of the enzyme is changed, making it unable to function properly.
*Enzyme names usually end in _-ase_.
* _Substrate_ - the substance on which an enzyme acts
*_Active Site_ - the specific site on the enzyme that binds to the substrate (the “business” end)
*Enzymes lower the _Activation_ energy of a reaction, meaning they lower the amount of energy needed for a reaction
to progress.

8
E. Enzyme Activity graphs: Use the graphs below to answer the following questions

Acid works best at a pH of 2-3. Trypsin works best at a pH of 8-9.

Top Chart Bottom Chart

Which enzyme above works well in acidic conditions? What is the substrate of amylase?
Pepsin Starch

Which enzyme above works well in basic conditions? What is the product of amylase?
Trypsin Sugar

What is optimal pH for pepsin? What does the graph indicate about adding amylase to
a starch solution?
2-3 More starch is digested at a quicker rate
What is the optimal pH for trypsin?

F. Chemical Reactions
Fill in the Blanks Using the Following Words: Hydrolysis Dehydration Synthesis

_Dehydration Synthesis_ - reaction that links monomers together (water is produced in this reaction)
*monomer + monomer polymer + water

_Hydrolysis___________ - reaction that breaks apart polymers into their monomers (water is broken and consumed)
*polymer + water monomer + monomer

9
IV. Energy: Photosynthesis/Respiration

A. Photosynthesis & Respiration and food chains & webs

What is the equation for photosynthesis? _Carbon Dioxide CO2 + Water H2O Yields Oxygen O2 + Glucose C6H12O6_
What are the reactants? What are the products? _Reactants: CO2 + H20 Products: O2 + C6H12O6_
What form of energy is produced by photosynthesis? _Sugar/glucose/C6H12O6_
In which cell organelle does photosynthesis occur? _Chloroplasts_
What is the equation for respiration? _O2 + C6H12O6 yields CO2 + H20_
What are the reactants? What are the products? _Reactants: O2 + C6H12O6 Products: CO2 + H2O_
What form of energy is produced by respiration? _ATP_
Where in the cell does respiration take place? _Mitochondria_
B. The Carbon Dioxide/Oxygen Cycle

Fill in the Blanks Using the Following words:

heterotrophs, (4) CO2, (4) O2, glucose, chloroplasts, mitochondria, photosynthesis, chemical, respiration, autotrophs,
solar, (2) light, (2) C6H12O6, glucose, (2) water

a. _Autotrophs (plants)_use organelles called _Chloroplasts_in their leaves to collect _Solar (Sun)__ energy.
b. . _Photosynthesis__occurs so plants can make _C6H12O6 Glucose_to use for energy.
c. Photosynthesis converts _Solar (Sun)_energy into _Chemical (C6H12O6)_energy.
d. Photosynthesis uses _CO2_, _H20_ and _light_energy to form
_O2_& _C6H12O6_.
e. Animals that can’t make their own food are called
_Heterotrophs_.
f. Animals, plants, and fungi all use organelles called
_Mitochondria_ to perform a process called _Respiration__
which breaks down food molecules to produce ATP for energy.
g. Respiration uses _O2_ and _C6H12O6_
to produce_CO2__ and _H20_.
h. The gas released by respiration is _CO2_; the gas taken in by
photosynthesis is _H2O_________.
i. The gas taken in by respiration is _O2_; the gas released by photosynthesis is _O2__.
j. The letter _C_____ represents the rabbit dying and replacing nutrients in the soil.
k. The letter _A_____ represents carbon dioxide being taken in to perform photosynthesis.
l. The letters _B_____ and _E_____ show CO2 being released into the atmosphere by respiration.
m. The letters _F_____ and _D_____ show carbon compounds being ingested for metabolic purposes.

C. Fill in the cycle below.

10
1._____Sunlight________ 2. __Chloroplast___________
(energy to photosynthesis) (what is this organelle?)

3. _CO2_________ and _H2O__________ 4. _O2______________ and __C6H12O6______

(products of respiration) (products of photosynthesis)

5. ____________ATP_______________ 6. _Mitochondria__________________
(energy made from respiration) (what is this organelle?)

D. Cellular Respiration – converts _C6H12O6_ energy stored in glucose into _ATP___.

*General equation: O2 + C6H12O6 _CO2________ + __H2O______ + energy in the form of _ATP_.
*Pathway depends on the organism and oxygen conditions. Regardless, the first step is glycolysis.
* Glycolysis – is splitting sugar
E. Aerobic respiration uses _Oxygen_ to break down _C6H12O6__ which results in __ATP__, _CO2__, and _H2O__.
F. Anaerobic respiration does not use oxygen. It is used by unicellular organisms that need less energy.
Anaerobic respiration – purpose is to regenerate NADH so glycolysis can continue. Two types:
1) _ Lactic Acid_ fermentation – occurs in fatigued muscle cells; used when producing cheese and yogurt; lactic acid is a
waste product.
2) _Alcoholic_ fermentation – occurs in some yeast cells; used to produce beer, wine and _Alcohol_. Alcohol is produced
as a waste product.

V. Cell Division: Cell cycle, mitosis, meiosis, DNA, protein synthesis

A. Cell Cycle

11
Identify the following stages of mitosis and indicate the correct order.

A. _Prophase_____________ B. __Telophase_____________________ C. _Anaphase____

D.__Interphase_____________________ E. _Metaphase___________

1. What order should the phase above be in? _Interphase_ _Prophase__  _Metaphase_  _Anaphase_ 
_Telophase_  _Cytokinesis__

2. The Cell cycle is made of two stages: _Interphase_ and cell division. Interphase consists of 3 phases: _G1_, _S_
and _G2_. During the _S_ phase DNA is copied.

3. Look at the picture to the right. What is the term for this process? Crossing Over

b. In what phase of meiosis does the following occur? Prophase

c. What does this process cause in the gametes? Genetic Variation

4. If a gamete of an organism has 6 chromosomes, how many will its body cell have? _12_

5. 7. If a liver cell of an organism has 32 chromosomes, how many will its gametes have? _16__

B. Mitosis

12
Fill in the Blanks Using the Following Words:

replicated, interphase, prophase, metaphase, anaphase, telophase, cytokinesis, centromere, sister chromatid,
chromatin, centrioles, spindle fibers, plate, furrow, centromere, cytokinesis, prophase, telophase

1. A chromosome is made of two identical parts called _Sister Chromatids_.

2. The parts of a chromosome are held together by a _Centromere_.
3. Only animal cells have _Centrioles_ to help with chromosome movement.
4. During _Anaphase_ sister chromatids are separated at the _Centromere__ and are pulled to opposite ends of the cell.
5. DNA is _Replicated_ during _interphase_ so each cell will have the same information.
6. Chromosomes line up along the equator of the cell in _metaphase_.
7. Loose or uncoiled chromosomes are actually DNA in the form of _Chromatin_.
8. During _Telophase_ spindle fibers shorten which pulls chromosomes to the poles.
9. After the nucleus divides, _Cytokinesis_, or division of the cytoplasm, occurs.
10. In plant cells only, a cell _Plate_ forms during _Cytokinesis__.
11. In animal cells only, a cell _Furrow_ forms during _Cytokinesis__.
12. _Spindle Fibers_ are attached to chromosomes at the centromere
13. _Prophase_- chromatin condenses and becomes visible chromosomes
14. The picture to the right is an onion cell going through _(no picture)_.
15. _Prophase__- nuclear membrane begins to disappear
16. _Cytokinesis__- two daughter cells are formed
17. _Telophase__- nuclear membrane begins to form around each set of chromosomes

13
C. Other types of division and Asexual Reproduction in Organisms

Fill in the Blanks Using the Following Words:

binary fission, budding, mitosis, sporulation, vegetative propagation, regeneration

1. _regeneration___________________________ - repairing severed appendage (starfish or lizard tail)

2. _Vegetative Propagation__________________- growing new roots for a plant from plant clippings
3. _Sporulation____________________________- new mold growing where spores have fallen, also occurs in ferns
4. _binary fission___________________________- only occurs in prokaryotes
5. _budding_______________________________- occurs in yeast and hydra when a tiny bud sprouts from a parent
6. _mitosis________________________________- occurs in single celled eukaryotes like paramecium, splitting the
nucleus

D. Meiosis

Fill in the Blanks Using the Following Words:

gametes, 1, the same, 46, 23, eggs, sperm, homologous, diploid, half, 2, haploid, prophase, zygote, fertilization

1. Meiosis is a type of cell division that makes sex cells or _gametes__.

2. The two types of sex cells are _sperm__ and _egg__.
3. Mitosis consists of _1_ division(s), while meiosis consists of _2__ division(s).
4. Mitosis makes cells with _the same_ number of chromosomes as the parent cell, but meiosis produces cells with
_half_ the number of chromosomes as the parent cell.
5. A human’s body cells have _46_ chromosomes; sex cells or gametes have __23__.
6. For every chromosome your mother gave you, there is a _homologous__ chromosome from your father with
information regarding the same trait(s).
7. When a cell has a full complement of homologs from each parent, the cell is said to be _diploid_ (2n).
8. Sex cells have only ONE set of chromosomes, they are called _haploid__.
9. When egg and sperm combine during _fertilization__, the _zygote__ that is formed has the normal 2n number of
chromosomes.

14
E. Mitosis vs. Meiosis

Complete the chart below by checking off which cell division has which characteristics

Description Mitosis Meiosis Neither

Cell division in body cells X
Cell division in gametes X
Eukaryotic Cells X X
Produces haploid cells X
Produces diploid cells X
Produces 2 cells X
Produces 4 cells X
Used by bacteria to divide X

VI. DNA
A. DNA & Protein Synthesis – the central dogma (DNA mRNA protein)
Fill in the Blanks Using the Following Words:
anticodon, nucleus, attaches, mRNA, unzips, single, protein, ribosome, mRNA, tRNA, pore, ribosome, codons, nucleotides, double,
S, Cytosine, Thymine, two, one, one, cytoplasm
B. Structure of DNA and RNA
DNA and RNA are made of _nucleotides_. Each nucleotide consists of three parts:
1) 5-carbon sugar (DNA = deoxyribose; RNA = ribose)
2) Phosphate (PO4)
3) Nitrogenous Base (DNA = ATGC, RNA = AUGC)
DNA is _double_-stranded and in the shape of a double-helix while RNA is _single_-stranded.
C. DNA replication
Before a cell enters mitosis, the DNA replicates itself so that each daughter cell receives a copy of the DNA.
This occurs during the _S_ phase of the cell cycle.
1) An enzyme _unzips_ the strand by breaking the hydrogen bonds between nitrogenous bases.
2) Another enzyme _attaches_ free nucleotides to the exposed templates.
Base-pairing rules – Adenine bonds with _Thymine_ and Guanine with _Cytosine_. Replication results in
_two_ new molecules of DNA, each made of _one_ strand of old and _one_ strand
of new DNA.
D. Protein synthesis – Two major steps
1) Transcription – production of _mRNA_ from the DNA template. Happens in the
_Nucleus_ of eukaryotic cells.
a) An enzyme temporarily unzips a gene to be read. At the same time, it builds a strand of
_mRNA_ that is complementary to the DNA.
b) When RNA polymerase finishes, the mRNA is released and travels to the _ribosome_. It
exits through a structure known as a nuclear _pore or membrane_.
2) Translation – production of a _protein_ from the mRNA template. Happens in the
_cytoplasm_ and is accomplished by structures called _ribosomes_.
a) Ribosomes read the mRNA in 3-base segments called _Codon_. A codon chart can be
used to determine which amino acid will be brought to the ribosome when this codon is
encountered.
b) A different type of RNA called _tRNA_ carries individual amino acids to the ribosome.
Each tRNA has a 3-base region that is complementary to a codon – this is called an
_anticodon_.

15
E. Scientists
_C_____ Hershey & Chase a. Discovered A-T and G-C base-pairing rules
b. Built first 3-d model of DNA
_D_____ Franklin
c. Discovered DNA is the genetic material
_A_____ Edwin Chargaff d. X-ray photo of DNA which gave clues to DNA’s helical structure
B______ Watson & Crick

F. Identify the following parts of the DNA molecule

Adenine, Guanine, Thymine, Cytosine, Phosphate, Deoxyribose, Hydrogen Bond

G. Circle the answer that best completes the sentence.

1. Protein Synthesis occurs on structures called ribosomes/nuclei

2. mRNA is made in the nucleus/cytoplasm.
3. DNA Replication occurs in the nucleus/cytoplasm
4. tRNA and Amino Acids are floating around in the nucleus/cytoplasm.
5. DNA is double/single stranded.
6. DNA contains thymine/uracil.
7. RNA contains the sugar deoxyribose/ribose.
8. Transcription produces mRNA/tRNA.
9. Translation produces mRNA/tRNA.
10. Replication produces DNA/RNA.

H. Complete the following table

DNA A T G G T A C C A

DNA T A C C A T G G T

Replication

mRNA A U G G U A C C A

tRNA U A C C A U G G U

16
I. Transcription and Translation:

Use the codon chart below to transcribe and translate the following DNA sequence.

DNA STRAND - TACGGCCATTTCGATTTGAGCATC

1. mRNA ____________________________________________________

2. amino acids: _________________________________________________________________

______________________________________________________________________________

3. This protein is made of _Eight______________ amino acids. (give the number of amino acids)

J. DNA Technology

Fill in the blanks using the following words:

DNA sequence, genes, profiling, identical, fraternal, collaborative, same

1. DNA _Profiling______________________ is used to identity crime suspects (such as murder and rape).

2. Using electrophoresis, scientists can determine an individual’s DNA fingerprint.

No 2 people have the _Same___ profile, except for _identical_ twins.

3. Human Genome Project was a _Collaborative_ effort because 13 countries worked on it.

4. The objective of the Human Genome Project was to understand the _DNA Sequence_.

5. Scientists wanted to determine the sequence of bases to find the _Genes__

responsible for diseases.

6. Look at the electrophoresis sample below. Who is the father of the child? _Dad 2__
dad 1 dad 2
baby mom

17
VI. Genetics

A. Vocabulary Word Bank:

phenotype, gene, heredity, genetics, genome, recessive, dominant, Gregor Mendel, trait, genotype, alleles,
homozygous, heterozygous

1. _hetero_______________- two different alleles, a hybrid (Tt)

2. _heredity______________- is the passing of characteristics from parent to offspring
3. _genotype______________- is the type of genes or alleles present in an organism’s genome
4. _dominant_____________- form of gene that always shows even in the presence of recessive allele.
5. _genome_______________- all of the genes in an organism
6. _alleles________________- are different forms of the same gene (ex: tall vs. short)
7. _homo_________________- two alleles of the same form that make up a genotype, pure breed (TT or tt)
8. _Gregor Mendel_________ is the Father of Modern Genetics
9. _recessive______________- form of a gene only expressed in a homozygous state
10. _trait_________________- is an inherited characteristic
11. _phenotype____________- is an organism’s physical appearance
12. _genetics______________- is the study of heredity
13. _gene_________________- is a segment of DNA located on a chromosome

B. Mendel’s Experiments:
Independent Assortment, F1 – first filial, F2 – second filial, Segregation, Dominance

1. Mendel’s experiments involved a parental generation (P-generation) that was true-breeding. Each parent had a
different phenotype (ex: purple x white). The offspring of the P-gen were considered the _F1________ generation (and
were all purple).
2. When the F1 was crossed with itself, these offspring were considered the _F2______ generation
(white re-appeared).
3. Mendel developed three principles based on his mathematical analysis of his experiments with pea plants:
1. The principle of _Dominance___________________ states that some alleles are dominant and some are recessive.
2. The principle of _Segregation_________________ states that during gamete formation, alleles for a particular trait
will separate (or segregate) during meiosis.
3. The principle of _IA_______________________________ states that genes for different traits do not influence each
other’s inheritance.
C. Punnett Squares – shows possible outcomes of a mating and predicts what
proportion of the offspring will have a given genotype

*Monohybrid crosses – deals with only _1______ trait at a time.

(ex: red x white flowers) Fill in the square to the right.
18
Complete the following Punnett squares.

1. a. Fill-in the Punnett Square: Tt X TT

b. How many offspring will be tall? _________

c. What percentage will be short? __________

2. A heterozygous brown bear (B) was crossed with a black bear (b).
a. Fill-in the Punnett Square.
b. What are the possible genotypes of the offspring?

c. What are the possible phenotypes of the offspring?

3. A homozygous brown bear is crossed with a homozygous brown bear.

a. Fill-in the Punnett Square.

b. What are the possible genotypes of the offspring?

c. What are the possible phenotypes of the offspring?

*Dihybrid cross - involves 2 traits at once. Be sure to show independent assortment of alleles
HINT: Use the FOIL method to get possible combinations.
TtRr x TtRr
Fill in the square to the right.

D. Alternative Inheritance
_____________ dominance – blending of phenotypes Show the cross of a white and pink flower below:
Ex: snapdragon flower color
-Only two alleles: red(R) & white(W)
-Heterozygotes show blending of phenotype
-RR __________ flower
-RW _________ flower

19
-WW _________ flower What % should be pink? _______ red? _______ white? _______
*Alternative Inheritance (cont.)
Word Bank:
Polygenic multiple X XX codominance 2 Y XY

1. When more than two alleles exist for a trait in the population, this is called _mulitple_ alleles.
2. However, each individual can only possess _2_ alleles of the possible ones (one from mom, one from dad).
Ex: Human blood types – 3 alleles are A, B, and O
3. _Codominance_ - when two alleles are both expressed fully if present
Ex: Human blood type – A and B are codominant. A person with genotype I AIB will have type AB blood.
4. Some characteristics are determined by several genes – this is called _polygenetic_
inheritance. Height, weight and skin pigmentation are examples of traits controlled by many genes.
5. Sex-linked traits – genes carried on the sex chromosomes (_X___ and _Y__) are considered sex-linked.
-Genes on the X-chromosome are said to be X-linked.
Examples are red-green colorblindness and hemophilia.
-Females carry the alleles _X__ and males carry the alleles _Y__.

6. Fill in the Punnett square to the right and write the phenotype/sex of all possible
offspring.

1 colorblind male = XrY

2 normal females = XRXR, XRXr
1 normal male = XRY

7. A man with type AB blood marries a woman with type O blood. Give the genotypes and phenotypes of all
possible offspring.

Genotypes:___AO, BO_____________________

Phenotypes: _Type A, Type B_______________

Blood Types:

A = AA or AO
B = BB or BO
AB = AB
O = OO
20
E. Pedigrees – used to show inheritance of traits through different generations.

1. Squares represent _males__.

2. Circles represent _females__.

3. Horizontal lines between a circle and square represent a

_marriage_.

4. Vertical lines coming down from a horizontal line represent

_children_.

5. _shaded_ shapes represent individuals with the trait.

6. _empty_shapes represent individuals without the trait.

7. Is this a dominant or recessive trait? recessive 9. Is this a sex-linked trait? yes

8. How can you tell? 10.How can you tell? Only males have the trait.
The male with the trait should have had children express the trait if it was dominant.

F. Genetic Disorders
Word Bank:
21st, Down Syndrome, karyotype, trisomy, chromosomal

1. Only a _Karyotype_ detects a _chromosomal_ mutation caused by nondisjunction.

2. Down Syndrome is __trisomy__ on the _21st_ chromosome pair.

3. Identify the disorder of the following karyotype: _Down Syndrome__

4. Identify the gender of the following karyotype: _female________

21
G. Applied Genetics

Word Bank: DNA Inversion substitution helpful 2 Translocation frameshift

deletion harmful sex cells Duplication
Genetic variation – variation is caused by mutations to genes, which are shuffled and recombined during meiosis and
fertilization
Mutations – changes to genetic material; must occur in _sex cells_ to be passed on to offspring - mutations may be
neutral, _helpful_, or _harmful_ depending on what is changed.
1) Chromosomal mutations – changes to entire chromosomes or pieces of them; Name the 4 types shown below
_Deletion_________ _Inversion________ _Duplication______
__Translation_____
_______ ________ __________
__________

2) Point (gene) mutations – changes to one or a few nucleotides in a particular gene

a) _Substitution___________ – one base is changed to another (ex: A instead of a T)
b) _Frame Shift___________ - results from an insertion or deletion of one nucleotide;
shifts reading frame

Genetic Engineering – the use of special biochemical techniques to manipulate _DNA____________.

Recombinant DNA – a piece of DNA containing genes from _Two___________________________ organism

VIII. Evolution

A. Matching

1. _D__ Theory that eukaryotes formed from prokaryotes in

symbiotic relationships.
2. _F__ A change in genetic material.
3. _H__ Accurate fossil age based on amounts of radioactive
A Coevolution
isotopes like uranium.
B Convergent evolution
4. _J__ Formation of a new species by some form of isolation.
C Directional selection
5. _B__ Unrelated organisms acquire similar characteristics
D Endosymbiosis
because of similar environments.
E Extinction
6. _C__ Population has a trait that moves toward an extreme
F Mutation
because of environmental pressure.
G Punctuated equilibrium
7. _E__ Species no longer exists on Earth.
H Radioactive dating
8. _G__ Evolutionary pattern of stability interrupted by rapid
I Relative dating
changes.
9. _I__ Approximate age of fossil is determined by where it fits
in the fossil record.
10. _A__ Two species evolve in response to changes in the
other.

22
B. Charles Darwin

Word Bank: Acquired Characteristics Natural Selection Beagle diversity gradualism Galapagos
equilibrium On the Origin of Species

1. British naturalist who sailed on H.M.S. _Beagle_ around the world, making many important

observations of biological _Diversity__.

2. Observations of finches, turtles and marine iguanas on the __Galapagos__ islands were very

influential for Darwin.

3. Supported _Gradualism___ - the idea that evolution occurs slowly but steadily over time.

4. The opposite idea, proposed by Stephen Jay Gould, hypothesizes that organisms evolve rapidly in bursts,

followed by time unchanged (punctuated _Equilibrium__).

5. Darwin suggested that random variations take place in living things resulting in some individuals being

better able to survive. Those with better traits are more likely to survive until reproduction, during which their

beneficial variations are passed on to the next generation. Darwin called this process _Natural__

_Selection_.

6. Darwin published his theory in a book called _On the Origin of Species_.

7. J.B. Lamarck – proposed “Use and Disuse” or “_Acquired Characteristics_” before

Darwin. Thought traits acquired during an organism’s lifetime were passed on to offspring. (ex: giraffe neck

becoming longer each generation because each individual stretches their neck longer during their lifetime).

Lamarck was disproven. We now understand why most acquired traits do not change genes, and are

therefore not inherited by their children.

Short Answer: Using the diagram to the right, answer the question

1. The forelimbs of the organisms are examples of what types of

structure?
_Homologous__________
Evolution- the theory that there is a gradual change in characteristics
over time.

23
B. Origin of Life – Scientists Hypotheses: Disproving Spontaneous Generation

Word Bank: sealed, bacteria, open, gauze, vital, air, spontaneously

a. Through the early 1800s, people believed organisms could develop _Spontaneously__
an idea know as spontaneous generation.
b. In 1668, many believed maggots spontaneously generated from rotting meat. Francis
Redi’s experiment disproved this by experimenting with meat in _Open_ jars,
_Sealed_ jars and jars covered with _Gauze__.
c. Some people still supported spontaneous generation but thought that air
was a _Vital_ force, necessary for it to occur.
d. In 1859, Louis Pasteur completely disproved spontaneous generation
by using a special flask that allowed _air_ in but captured
bacteria before they could get to
the broth. No _Bacteria_ grew in the flask after boiling.
There was no spontaneous generation.

D. First Life
Word Bank:

prokaryotic, variety, eukaryotic

organic, photosynthesis, oxygen

a. Earth’s atmosphere had to be very hot and with little

oxygen for the first _Organic_ molecules to form.
b. _Prokaryotic_ cells were the first to evolve.
c. When cells gained the ability to do
_Photosynthesize_, they used up carbon
dioxide and put more _Oxygen_ into the
atmosphere.
d. With more oxygen in the atmosphere, a wider
_Variety_ of organisms evolved on land.
e. Some cells engulfed each other leading to the formation
of more complex cells with a nucleus and other organelles
creating _Eukaryotic_ cells.

24
IX. Classification, Taxonomy & Kingdoms
1. Place the following characteristics in the proper Kingdoms. Those that are used more than once have
the number of times they will be used in parentheses.

yeast eukaryotes(4) prokaryotes only heterotrophs(2) moss

mushroom protozoan dicot algae tree
amphibian jellyfish only autotrophs mold reptile
conifer only unicellular multicellular (3) multi- & unicellular fern
flower bird fish mammals monocot
decomposer (2) cellulose cell walls insects E.coli
hetero- & autotroph (2)

K. Animalia K. Plantae K. Fungi K. Protista K. Archaebacteria &

Eubacteria
Eukaryotes Eukaryotes Eukaryotes Eukaryotes Prokaryote
Only Heterotrophs Only Autotrophs Only Heterotrophs Multicellular Only Unicellular
Multicellular Multicellular Multicellular & Unicellular decomposer
jellyfish Conifer Yeast Decomposer hetero & Auto trophs
amphibian Flower Mushroom Heterotrophs & E. Coli
bird Cellulose Mold Autotrophs
fish Dicot Protozoan Algae
mammals Cell Walls
insects Moss
reptile Tree
Fern
Monocot

2. The diagram below is a cladogram which shows evolutionary relationships between organisms.
a. Which 2 organisms are the most related? B&C (mya = millions of years ago)
b. How long ago did A & D split? 3 MYA
A B C D E F G
c. Which organism is most related to G? F
d. Which 2 organisms are the LEAST related? A & G 1 mya
e. Which 2 organisms are MORE related: D & E or E & G? E & G 3 mya
f. Which 2 organisms are LESS related: A & D or D & F? D & F
g. Which 2 organisms split ~8 mya? A & G 8 mya
h. Which organisms would be in the same phylum as G? E & F
i. If organism B is Felis domesticus, what is the most likely genus of organism C? Felis 11 mya
j. Which organism has changed the least in 11 million years? A

25
Classification cont.
3. Hierarchy of classification – created by __Linnaeus_, a Swedish botanist.
4. __Kingdom__, Phylum, _Class__, Order, _Family_, Genus, _Species_
(Domain has recently been added)
5. Organisms named by Genus species (binomial nomenclature). What is the scientific name of a human?
Homo Sapiens
6. Use the dichotomous key to identify the flower.
Starflower: Trientante borealis

7. Use the diagram to the right to answer the following questions.

Which species went extinct?

How long ago?

10 MYA

8. Which of the beetles below are most closely related? Justify your
answer.

Oak Weevil & Hazelnut Weevil

both have the same genus

26
B. Viruses- Word Bank:
vaccines, host, lysogenic, capsid, bacterial, living, diseases, cells, DNA, lytic, RNA

1. Not considered _living_because they need a _host_ cell to reproduce and are not made of _cells__________.
2. Cause _diseases___________ such as AIDS, common colds, flu, and genital warts.
3. Basic structure consists of a _capsid_ (protein coat), nucleic acid core (can be _DNA_ or _RNA_).
4. Two types of life cycles 1) _Lytic_ – viral entry, assembly of new viruses, burst out of cell 2) __Lysogenic_ – viral
entry, hides as a provirus and is copied when cell divides, enters lytic cycle when triggered.
5. _Vaccines__ are used to prevent viral infection; made of non-functional virus parts that trick our immune
systems.
6. Viral infections cannot be treated with antibiotics. Only _Bacterial__ infections can be treated with antibiotics.
C. Bacteria
Shapes: _Bacillus_ (rod), __Coccus__ (spherical) or _Spirillium_ (spiral)

D. Kingdom Protista (The “everything-else” kingdom)

Word Bank: cilia algae flagella pseudopods protozoa
Most unicellular but some are multicellular
Some cause diseases such as malaria.
Classified based on nutrition:
1) Plant-like protists – “__Algae_” ; All are mostly autotrophic
2) Animal-like protists – “_protozoa___” ; All are heterotrophic
3) Fungus-like protists – slime molds & water molds; All are heterotrophic/saprobic

How do the following cells move to the right?

A. _Cilia_
B. _Pseudopods__ A B C
C. _Flagella__
E. Kingdom Fungi (Molds, mushrooms, yeast, mildew)
Word Bank: chitin, fungus, hyphae, outside, multicellular, eukaryotic, algae
1. Cell type: _Eukaryotic_
2. # of cells: most _Multicellular__; yeast is unicellular
3. Cell wall made of: _Chitin_
4. Digest food _Outside__ of their bodies (extracellular digestion)
5. Composed of microscopic filaments called _Hyphae_.
F. Lichens
Example of mutualism between a __Fungus__ and an _Algae__.

X. Ecology

27
Ecology - how organisms interact with each other and their environment
Ecological hierarchy from largest to smallest: _Biosphere_, Biome, _Ecosystem_, Community,
Population, Individual
A. Biomes – Large geographic areas with characteristic __Climate__ ranges, rainfall, and organisms.
1) _Terrestrial_-land-based biomes
2) _Aquatic__ - water-based biomes
B. Ecosystems – defined by characteristic biotic and abiotic factors
1) biotic factors – living
2) abiotic factors – non-living
3) Niche – Area where organisms live and thrive
C. Ecosystem dynamics
Trophic levels – feeding levels, often represented as levels on a pyramid
Biomass – total _growth_________ or organic matter at each trophic level
1) Producers – autotrophic; highest biomass
2) Primary consumers – eat autotrophs; lower biomass
3) Secondary consumers – eat primary consumers; lower biomass
Scavengers- Eat left overs
Herbivores- Eat Plants
Carnivores- Eat Meat
Omnivores- Eat Meat & Plants
Community – consists of _All______the organisms that live in an area.
Population – all the organisms of the same _Species__________ living in an area.

D. Growth Curve
1)Limiting factors – conditions that _decrease_ the size of a population. List three
possible limiting factors:

2) Exponential growth – growth rate in each new generation is a multiple of the

previous generation (Letter _B___ on the graph)
3) Carrying capacity – maximum number of organisms that can be supported by
environmental resources (Letter __E___ on the graph)
4) Symbiotic relationships – two organisms live closely together;
a) parasitism – parasite _Benefits_____________ while the host is _harmed____________.
(eg. ticks, fleas, tapeworms)
b) mutualism – both parties __benefit_______________ (eg. lichens, nitrogen-fixing bacteria in root nodules)
c) commensalism – one benefits, the other is mostly _unaffected__________________ (eg. orchids, vultures follow
hyenas)
E.Food Chains and Webs – graphical displays of energy transfer between and among
trophic levels
Food chain – linear (straight line)
Food web – shows all the interconnected food chains in an ecosystem
In chains and webs, arrows point in the direction of energy flow (from prey to predator)
Using the food web at right:
a) Where do killifish get their energy?___Copepod & Larvae_______________________
b) How many different organisms get energy from snappers? __5___
c) Do orcas get energy indirectly from diatoms? __Yes______
d) Which organism provides nutrients for the largest number of organisms?
Snapper

28
F. Ecological Succession – community changes in which new populations or organisms gradually replace existing ones
Occurs because of natural or human disturbance (volcanic eruption/deforestation)
1) _Pioneer______________ communities – first to colonize an area; gradually
replaced by members of the climax community
2) Climax community – community that has reached relative stability; VA climax
community is mostly oak/hickory deciduous forest.
Order the steps of succession (A-D) in the diagram at right _C, A, B, D_____
G. Nutrient Cycles
Water cycle (define the terms)
1) Precipitation- Water falls from the sky
2) Transpiration – Water leaves the plants
3) Evaporation - Water rises to the sky
4) Runoff – Water flows down land to rivers and streams
H. Carbon and Oxygen cycles – (Word Bank: burned, H2O, autotrophs, CO2, respire,
O2, aerobic, food)
1) Photosynthesis releases _O2_____ from _Autotrophs__ .
2) Respiration releases _CO2_______ from _Food_______ .
3) Carbon dioxide is released when fossil fuels are _Burned_, and when organisms
_respire_.
4) Oxygen is produced by _Autotrophs___ during photosynthesis.
5) Oxygen is consumed by __Aerobic__________ organisms for use during cellular respiration.

I. Nitrogen Cycle
1) Nitrogen __Fixation___________________ - converting gaseous nitrogen in atmosphere into usable forms.
a) What organisms are the primary fixers of nitrogen? _Bacteria___________________
2) _Denitrification___________________________ - process by which bacteria break down nitrogen compounds and
release nitrogen gas back into the atmosphere.

XI. Kingdom Plantae

Plants!
1. cell type: __Eukaryote____________________
2. # of cells: __Multicellular___________________
3. nutrition: __Autotroph______________________
4. cell walls contain: _Yes_________________
5. classified based on vascular tissue, seeds and flowers
Plant Kingdom
Vascular ( contain xylem and phloem) Non-Vascular- Bryophytes
(mosses)

Seeded Seedless

Angiosperm- seeds Gymnosperm-seeds

enclosed by protective naked; produced in
__Fruit__ (flowering _Cone_ (conifers)
plants)

Monocots Dicots

6. Flowers are structures specialized for _Sexual____ reproduction.

7. The male part is called the _Stamen___________________. Pollen is produced in the __Anther___.
29
8. The female part is called the __Pistal__. Eggs are produced in the __Ovary_____.
9. Identify structures 1-5 from the flower picture.
1. Anther
2. Style
3. Ovary
4. Petal
5. Sepal

XII. Kingdom Animalia

Animals!
1. Cell type: _Eukaryotes________________________
2. # of cells: _Multicellular________________________________
3. Do animals have a cell wall? _No______ chloroplasts? __No_________
4. Nutrition: _Heterotrophs_________________________
5. Most have tissues and body symmetry
-__Radial_____________ symmetry – any number of imaginary planes passing through the center of
the organism from top to bottom will divide it into equal halves (ex: corals and jellyfish)
-_Bilateral_______________ symmetry – only one imaginary plane divides the organism into equal halves
(ex: humans and insects)
6. Most show _Cephalization_______________________ - a concentration of sense organs on one end of the body
7. Most animal species are __Invertebrates____________________, meaning they have no backbone.
Major Animal Phyla – (Word Bank: cartilage, bilateral, spiny, mammary, scaly, feathers, radial, soft, bone,
oxygen, sponges, segmented, jointed, moist, exoskeleton, wings
1) Porifera – simplest, no tissues/organs, filter-feeders (ex:. __Sponges______________)
2) Cnidaria – _Radial____________ symmetry, stinging cells, polyp & medusa form (ex: corals, jellyfish, sea
anemones)
3)Platyhelminthes – simple tissues, organ systems, cephalized, __Bilateral___________ symmetry, free-living
and parasitic (ex: flatworms)
4) Annelida – __Segmented__________________ bodies, complex organ systems (ex: roundworms, leeches)
5) Mollusca – _Soft________-bodied; some make shells; have muscular “foot”; internal organs (ex: snails, slugs,
clams, squid, octopus)
6) Arthropoda – segmented body; tough __exoskeleton_________________; __jointed____ appendages;
complex organ systems (ex: insects, spiders, crabs, lobsters, scorpions, crustaceans)
7) Echinodermata – _spiny_____________ skin; internal skeleton; suction-cuplike tube feet (ex: starfish, sea
urchins, sand dollars)
8) Chordata – notochord; backbone in most (exception: tunicates and lancelets)
Major Chordate Classes
a) Chondrichthyes – skeletons made of __cartilage____________________ (ex: sharks, rays, skates)
b) Osteicthyes – skeletons made of __bone______________ (ex: bony fishes such as goldfish, tuna, trout)
c) Amphibia – water & land life stages; breath w/lungs as adult; _moist_______ skin; lacks scales & claws
(ex: salamander, frog)
d) Reptilia – dry, __scaly___________ skin; lungs; terrestrial egg-layers (ex: lizards, snakes, turtles)
e) Aves – __feathers_________ for flight; legs with scales; front limbs modified into _wings___ (ex: all birds)
f) Mammalia – hair; ___mammary_ glands; breathe __oxygen____ (ex: platypus, bears, cow, human)

30